Review



mt4 nih aids reagent program nih arp  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC mt4 nih aids reagent program nih arp
    Mt4 Nih Aids Reagent Program Nih Arp, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 38021 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mt4+nih+aids+reagent+program+nih+arp/293T/pm31775044-203-146-157
    Average 99 stars, based on 38021 article reviews
    mt4 nih aids reagent program nih arp - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Staining:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..

    Selection:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..

    Lysis:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..

    Recombinant:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..

    Software:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..

    FACS:

    Article Title: Flt3L-Mediated Expansion of Plasmacytoid Dendritic Cells Suppresses HIV Infection in Humanized Mice.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER IFNɑ-2a PBL Science Cat # 11100-1 Critical Commercial Assays COBAS AmpliPrep/COBAS TaqMan HIV-1 test (Version 1) Roche https://diagnostics.roche.com/ Fixation/Permeabilization Solution Kit BD Biosciences Cat # 554714 Foxp3 transcription factor staining buffer set eBioscience Cat # 00-5523-00 Fixable violet dead cell stain kit ThermoFisher Cat # 34963 RNeasy Mini plus kit QIAGEN Sciences Cat # 74136 QIAamp DNA mini kit QIAGEN Sciences Cat # 51304 Human CD34+ selection kit Mitenyi Biotec Cat # 130-100-453 Powerup Sybergreen Mastermix Applied Biosystems Cat # A25741 TaqMax Fast Advanced Master Mix Applied Biosystems Cat # 4444556 QIAzol Lysis Reagent QIAGEN Sciences Cat # 79306 Experimental Models: Cell Lines Human: ACH2 cells NIH AIDS Reagent Program NIH-ARP Cat# 349-443, RRID:CVCL_0138 Human: CEM.NKR-CCR5 NIH AIDS Reagent Program NIH-ARP Cat# 4376-29; RRID:CVCL_X623 Human: HelaTZM bl NIH AIDS Reagent Program NIH-ARP Cat# 8129-442; RRID:CVCL_B478 Human: HEK-Blue IFN-a/b InvivoGen RRID:CVCL_KT26 Human: MT4 NIH AIDS Reagent Program NIH-ARP Cat# 120-438, RRID:CVCL_2632 Human: 293T ATCC ATCC Cat# CRL-3216, RRID:CVCL_0063 Experimental Models: Organisms/Strains Mouse: NOD-scid IL2Rgammanull The Jackson Laboratory https://www.jax.org/ Oligonucleotides Primer: GAPDH Forward: GCCATCAATGACCCCTTCATT This paper N/A Primer: IFNɑ Forward: TCCATGAGVTGATBCAGCAGA This paper N/A Primer: IRF7 Forward: GAGCCCTTACCTCCCCTGTTAT This paper N/A Primer: Mx1 Forward: CAGCACCTGATGGCCTATCA This paper N/A Primer: OAS1 Forward: TGTGTGTCCAAGGTGGTAAAG This paper N/A Recombinant DNA psvCMV-VSV-G Eric Cohen; Lodge et al., 1997 N/A Software and Algorithms FACS Diva BD Biosciences https://www.bdbiosciences.com/en-us FlowJo (Versions 9.9.3 and 10.1) TreeStar https://www.flowjo.com Illustrator CC2018 Adobe https://www.adobe.com Prism (Versions 7 and 8) GraphPad https://www.graphpad.com ..



    Similar Products

    mt4 nih aids reagent program nih arp  (ATCC)
    99
    ATCC mt4 nih aids reagent program nih arp
    Mt4 Nih Aids Reagent Program Nih Arp, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mt4+nih+aids+reagent+program+nih+arp/293T/pm31775044-203-146-157
    Average 99 stars, based on 1 article reviews
    mt4 nih aids reagent program nih arp - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results